Review



semidry transfer apparatus  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher semidry transfer apparatus
    Semidry Transfer Apparatus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/pm40440959-72-23-26
    Average 90 stars, based on 1 article reviews
    semidry transfer apparatus - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Membrane:

    Article Title: Extramacrochaete promotes branch and bouton number via the sequestration of Daughterless in the cytoplasm of neurons
    Article Snippet: Equal lysate volumes were loaded into each well of NuPAGE 4–12% Bis Tris Gel (Invitrogen). .. Gels were run using MES running buffer and transferred to PVDF membrane (Immobilon Millipore) using a semidry transfer apparatus (Owl Scientific) and NuPage transfer buffer (Invitrogen). ..

    Article Title: Anc80 encoding sphingolipid-metabolizing proteins for mitigating disease-induced tissue damage
    Article Snippet: .. Reverse NO. AC ACAGGATTCAAACCAGGACTGT 21 TGGGCATCTTTCCTTCCGAA 22 AC TGACAGGATTCAAACCAGGACT 23 CTGGGCATCTTTCCTTCCGA 24 Sphk1 ATACTCACCGAACGGAAGAACC 25 CCATTAGCCCATTCACCACCTC 26 Sphk1 ACTGATACTCACCGAACGGAA 27 CATTAGCCCATTCACCACCTC 28 S1PR2 CACAGCCAACAGTCTCCAAA 29 TCTGAGTATAAGCCGCCCA 30 S1PR2 ATAGACCGAGCACAGCCAA 31 GAACCTTCTCAGGATTGAGGT 32 18s rRNA* TAACGAACGAGACTCTGGCAT 33 CGGACATCTAAGGGCATCACA 34 G *Genetic Vaccines and Therapy 2004, 2:5 Western Blot Upon thawing, hearts lysates' were subjected to separation by SDS-PAGE using 12% precast Nupage Bis/Tris gels (Invitrogen, Carlsbad, Calif., USA) under reducing conditions and MES running buffer (Invitrogen), and transferred onto a nitrocellulose membrane (Bio-Rad) using a semidry transfer apparatus and Nupage-MOPS transfer buffer (Invitrogen). ..

    Article Title: Traumatic Stress, Chronic Ethanol Exposure, or the Combination, Alter Cannabinoid System Components in Reward and Limbic Regions of the Mouse Brain
    Article Snippet: .. Protein extracts (PFC and anterior STR: 10 μg; NAc and dorsal HC: 20 μg; AMYG: 25 μg) from each sample were loaded and separated on a 4–12% Bis-Tris gel with 20X MOPS SDS running buffer (Thermo Fisher Scientific) and transferred to a nitrocellulose membrane using 20× transfer buffer (Thermo Fisher Scientific) on a semidry transfer apparatus (Thermo Fisher Scientific) at 15V for 40 min at room temperature. ..

    Article Title: Optimization of 5′ Untranslated Region of Modified mRNA for Use in Cardiac or Hepatic Ischemic Injury
    Article Snippet: Cell lysates were collected and subjected to SDS-PAGE in 12% precast NuPAGE Bis/Tris gels (Invitrogen) under reducing conditions in MES running buffer (Invitrogen). .. The resulting bands were transferred onto a nitrocellulose membrane (Bio-Rad) by blotting in a semidry transfer apparatus with NuPAGE-MOPS (3-( N -morpholino)propanesulfonic acid) transfer buffer (Invitrogen). ..

    Vaccines:

    Article Title: Anc80 encoding sphingolipid-metabolizing proteins for mitigating disease-induced tissue damage
    Article Snippet: .. Reverse NO. AC ACAGGATTCAAACCAGGACTGT 21 TGGGCATCTTTCCTTCCGAA 22 AC TGACAGGATTCAAACCAGGACT 23 CTGGGCATCTTTCCTTCCGA 24 Sphk1 ATACTCACCGAACGGAAGAACC 25 CCATTAGCCCATTCACCACCTC 26 Sphk1 ACTGATACTCACCGAACGGAA 27 CATTAGCCCATTCACCACCTC 28 S1PR2 CACAGCCAACAGTCTCCAAA 29 TCTGAGTATAAGCCGCCCA 30 S1PR2 ATAGACCGAGCACAGCCAA 31 GAACCTTCTCAGGATTGAGGT 32 18s rRNA* TAACGAACGAGACTCTGGCAT 33 CGGACATCTAAGGGCATCACA 34 G *Genetic Vaccines and Therapy 2004, 2:5 Western Blot Upon thawing, hearts lysates' were subjected to separation by SDS-PAGE using 12% precast Nupage Bis/Tris gels (Invitrogen, Carlsbad, Calif., USA) under reducing conditions and MES running buffer (Invitrogen), and transferred onto a nitrocellulose membrane (Bio-Rad) using a semidry transfer apparatus and Nupage-MOPS transfer buffer (Invitrogen). ..

    Western Blot:

    Article Title: Anc80 encoding sphingolipid-metabolizing proteins for mitigating disease-induced tissue damage
    Article Snippet: .. Reverse NO. AC ACAGGATTCAAACCAGGACTGT 21 TGGGCATCTTTCCTTCCGAA 22 AC TGACAGGATTCAAACCAGGACT 23 CTGGGCATCTTTCCTTCCGA 24 Sphk1 ATACTCACCGAACGGAAGAACC 25 CCATTAGCCCATTCACCACCTC 26 Sphk1 ACTGATACTCACCGAACGGAA 27 CATTAGCCCATTCACCACCTC 28 S1PR2 CACAGCCAACAGTCTCCAAA 29 TCTGAGTATAAGCCGCCCA 30 S1PR2 ATAGACCGAGCACAGCCAA 31 GAACCTTCTCAGGATTGAGGT 32 18s rRNA* TAACGAACGAGACTCTGGCAT 33 CGGACATCTAAGGGCATCACA 34 G *Genetic Vaccines and Therapy 2004, 2:5 Western Blot Upon thawing, hearts lysates' were subjected to separation by SDS-PAGE using 12% precast Nupage Bis/Tris gels (Invitrogen, Carlsbad, Calif., USA) under reducing conditions and MES running buffer (Invitrogen), and transferred onto a nitrocellulose membrane (Bio-Rad) using a semidry transfer apparatus and Nupage-MOPS transfer buffer (Invitrogen). ..

    SDS Page:

    Article Title: Anc80 encoding sphingolipid-metabolizing proteins for mitigating disease-induced tissue damage
    Article Snippet: .. Reverse NO. AC ACAGGATTCAAACCAGGACTGT 21 TGGGCATCTTTCCTTCCGAA 22 AC TGACAGGATTCAAACCAGGACT 23 CTGGGCATCTTTCCTTCCGA 24 Sphk1 ATACTCACCGAACGGAAGAACC 25 CCATTAGCCCATTCACCACCTC 26 Sphk1 ACTGATACTCACCGAACGGAA 27 CATTAGCCCATTCACCACCTC 28 S1PR2 CACAGCCAACAGTCTCCAAA 29 TCTGAGTATAAGCCGCCCA 30 S1PR2 ATAGACCGAGCACAGCCAA 31 GAACCTTCTCAGGATTGAGGT 32 18s rRNA* TAACGAACGAGACTCTGGCAT 33 CGGACATCTAAGGGCATCACA 34 G *Genetic Vaccines and Therapy 2004, 2:5 Western Blot Upon thawing, hearts lysates' were subjected to separation by SDS-PAGE using 12% precast Nupage Bis/Tris gels (Invitrogen, Carlsbad, Calif., USA) under reducing conditions and MES running buffer (Invitrogen), and transferred onto a nitrocellulose membrane (Bio-Rad) using a semidry transfer apparatus and Nupage-MOPS transfer buffer (Invitrogen). ..

    Expressing:

    Article Title: Cytoplasmic CPSF6 Regulates HIV-1 Capsid Trafficking and Infection in a Cyclophilin A-Dependent Manner
    Article Snippet: .. For measurement of CPSF6 expression in cells, an equal number of transduced and puromycin-selected HeLa cells or PBMCs were lysed with RIPA buffer (Bio-Rad), mixed with sample buffer (Bio-Rad), and heated to 100°C for 5 min. Denatured cell lysate was run on precasted 4 to 15% Criterion Tris-HCl gels (Bio-Rad) at 150 V for 1.5 h. Proteins were transferred to nitrocellulose membranes using a semidry transfer apparatus (Thermo Fisher Scientific) at 160 mA for 1 h. The membranes were blocked with 5% milk in PBS containing 0.1% Tween 20 at room temperature for 20 min. .. The primary antibodies anti-CPSF6 (NBP1-85676) and anti-α-tubulin (T5168; Sigma-Aldrich) were used with secondary anti-mouse IgG or anti-rabbit IgG conjugated with horseradish peroxidase antibodies (A9917 and AP132P; Sigma-Aldrich).



    Similar Products

    99
    Bio-Rad turbo blot semidry transfer apparatus
    Turbo Blot Semidry Transfer Apparatus, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/Trans-Blot+Turbo+Transfer+System/pmc12906115-108-13-18
    Average 99 stars, based on 1 article reviews
    turbo blot semidry transfer apparatus - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad semidry transfer apparatus
    Semidry Transfer Apparatus, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/Nitrocellulose+Membrane/10__1094_slash_pdis___07___24___1533___re-70-39-42
    Average 99 stars, based on 1 article reviews
    semidry transfer apparatus - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher semidry transfer apparatus
    Semidry Transfer Apparatus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/pm40440959-72-23-26
    Average 90 stars, based on 1 article reviews
    semidry transfer apparatus - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Bio-Rad semidry protein transfer apparatus
    Semidry Protein Transfer Apparatus, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/Trans-Blot+Turbo+Transfer+System/pm40257401-251-9-15
    Average 99 stars, based on 1 article reviews
    semidry protein transfer apparatus - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    PEQLAB semidry transfer apparatus
    Semidry Transfer Apparatus, supplied by PEQLAB, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/semi+dry+transfer+apparatus/pmc11850954-101-42-45
    Average 90 stars, based on 1 article reviews
    semidry transfer apparatus - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Hoefer semidry transfer apparatus hoefer te77xp
    Semidry Transfer Apparatus Hoefer Te77xp, supplied by Hoefer, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/te77xp+semidry+blotter/pm39966572-249-15-18
    Average 90 stars, based on 1 article reviews
    semidry transfer apparatus hoefer te77xp - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Bio-Rad turbo trans blot semidry apparatus
    Turbo Trans Blot Semidry Apparatus, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/semidry+transfer+apparatus/Trans-Blot+Turbo+Transfer+System/pm39666597-863-14-19
    Average 99 stars, based on 1 article reviews
    turbo trans blot semidry apparatus - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results